Gene name |
SPBP4H10.06c |
Gene ID |
34/A08 |
Gene synonyms/obsolete |
cut14 |
Gene product |
condensin subunit;
SMC2 subunit; essential; involved in chromosome condensation
(mitosis) (required); involved in chromosome segregation
(mitosis) (required) |
Entry clone |
Cloned in 2006
trial |
ORF length (unspliced) |
3519 |
ORF length (spliced) |
|
Entry clone length |
3519 |
No. of intron |
0 |
Sequence status |
Partially
sequenced |
Sequence results |
100% match in both
ends |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPBP4H10.06.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAAAATAGAGGAACTCAT |
Rev primer name |
SPBP4H10.06.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAGCGAGCTTGTACCACAGAT |
Amino acid length |
1172 |
Molecular weight |
134.1 |
Isoelectric point (calc.) |
8.1 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LDAICFVLGI/LPELDRLIL/LDEIDAALDL |
Localization (YFP) |
no expression clone
|
Comments for localization |
|
Effect of LMB on protein
localization |
not determined |
Microscope used for
observation |
|