Gene name |
SPAP7G5.04c |
Gene ID |
34/B03 |
Gene synonyms/obsolete |
lys1 |
Gene product |
aminoadipate-semialdehyde dehydrogenase |
Entry clone |
Cloned# |
ORF length (unspliced) |
4260 |
ORF length (spliced) |
|
Entry clone length |
4260 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
3448G:A |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPAP7G5.04.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGCCAGACGGCTCCAAG |
Rev primer name |
SPAP7G5.04.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAATGAGTTGGAGCGCCTCCA |
Amino acid length |
1419 |
Molecular weight |
156.8 |
Isoelectric point (calc.) |
6.3 |
Signal SEQ |
|
No. of transmembrane domain |
1 |
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LVTPFNILLTI/LKTYVPALKL |
Localization (YFP) |
cytosol |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |