| Gene name |
SPAC1486.04c |
| Gene ID |
34/B07 |
| Gene synonyms/obsolete |
alm1 |
| Gene product |
coiled-coil protein;
medial region associated during mitosis; deletion mutant
results in elongated cells; involved in cytokinesis;
non-essential; deletion mutant results in sporulation defects
(non-germinating spores); heterozygous mutant spores
germinated but produced smaller colonies |
| Entry clone |
Cloned |
| ORF length (unspliced) |
5184 |
| ORF length (spliced) |
|
| Entry clone length |
5184 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
494G:A / 719A:G /
827A:T / 1137T:A / 3130T:C / 4340A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC1486.04.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCTTCGGGGGGACTTGA |
| Rev primer name |
SPAC1486.04.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATTTGGCTTTCTTAACATCA |
| Amino acid length |
1727 |
| Molecular weight |
197.8 |
| Isoelectric point (calc.) |
5.2 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LQQKVSSLKL/LDSVMKLGL |
| Localization (YFP) |
nucleus; nuclear
dots |
| Comments for localization |
weak signal of
nucleus |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica,
DeltaVision |