| Gene name |
SPBC16D10.05 |
| Gene ID |
34/B09 |
| Gene synonyms/obsolete |
mok13 |
| Gene product |
a-1,3-glucan synthase;
alpha glucan synthase; glycosyl transferase family 1; similar
to Sp MOK1 and MOK11 and MOK14 and MOK12; involved in cell
wall biosynthesis; no apparent Sc ortholog |
| Entry clone |
Cloned |
| ORF length (unspliced) |
7117 |
| ORF length (spliced) |
7077 |
| Entry clone length |
7117 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
237A:G / 4790G:A |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC16D10.05.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCGAAATAAGAATATTCT |
| Rev primer name |
SPBC16D10.05.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAGGCCGACTTAAATTTTCT |
| Amino acid length |
2358 |
| Molecular weight |
269.1 |
| Isoelectric point (calc.) |
7 |
| Signal SEQ |
Predicted
(N-terminus) |
| No. of transmembrane domain |
13 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LKDSLDYLEI/LPNVIPCVLSL/LPSVASLSL/LIAVFSWPLAL/LGPGLVFLDL |
| Localization (YFP) |
no apparent
signal |
| Comments for localization |
|
| Effect of LMB on protein
localization |
not determined |
| Microscope used for
observation |
Leica |