| Gene name |
SPAC1527.01 |
| Gene ID |
34/B10 |
| Gene synonyms/obsolete |
mok11;
SPAC23D3.15 |
| Gene product |
a-1,3-glucan synthase;
alpha glucan synthase; glycosyl transferase family 1; similar
to Sp MOK1 and MOK12 and MOK13 and MOK14; involved in cell
wall biosynthesis; no apparent Sc ortholog |
| Entry clone |
Cloned# |
| ORF length (unspliced) |
7194 |
| ORF length (spliced) |
|
| Entry clone length |
7194 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPAC1527.01.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCGTACCCTCTTGTTGT |
| Rev primer name |
SPAC1527.01.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAGGTCGACTTAAATTTTCA |
| Amino acid length |
2397 |
| Molecular weight |
272 |
| Isoelectric point (calc.) |
5.9 |
| Signal SEQ |
Predicted
(N-terminus) |
| No. of transmembrane domain |
13 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LKRLSCLVI/LVIPLEKLRI/LEYDIPSLNI |
| Localization (YFP) |
ER |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |