Gene name |
SPAC4A8.05c |
Gene ID |
34/C05 |
Gene synonyms/obsolete |
myo3 |
Gene product |
myosin-3 isoform,
heavy chain (Type II myosin); involved in cytokinesis;
involved in contractile ring assembly; non-essential |
Entry clone |
Cloned |
ORF length (unspliced) |
6315 |
ORF length (spliced) |
|
Entry clone length |
6315 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
3573T:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC4A8.05.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCGTATCTTTCAAAAAA |
Rev primer name |
SPAC4A8.05.Rv |
Rev primer SEQ |
AGAAAGCTGGGTACCTTAGAACGCTAGGCGAA |
Amino acid length |
2104 |
Molecular weight |
242.5 |
Isoelectric point (calc.) |
6.5 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
1156/1157 |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LFLIIASILHI/LQHNLRQLKL/LMRLDDELLL/LELKLFDLDL |
Localization (YFP) |
mitochondrion |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica |