| Gene name |
SPCC74.06 |
| Gene ID |
34/C10 |
| Gene synonyms/obsolete |
mak3; SPCC74.06 |
| Gene product |
histidine kinase;
involved in signal transduction; His-to-Asp phosphorelay;
non-essential; functions upstream of Spy1p; function
overlapping with Mak2p and Mak1p; involved in mitotic cell
cycle control (implicated); involved in oxidative stress
response (implicated); involved in the regulation of sexual
development (required); PAC domain protein; similar to Sp mak2
and mak1; response regulator receiver domain |
| Entry clone |
Cloned |
| ORF length (unspliced) |
7035 |
| ORF length (spliced) |
|
| Entry clone length |
7035 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
1178A:G / 3229A:T /
4999A:G / 6050A:G / 7020T:A / 7021G:A |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPCC74.06.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTATTCTCAGCATGAACT |
| Rev primer name |
SPCC74.06.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATGAAGTATTAGCATTTCCA |
| Amino acid length |
2344 |
| Molecular weight |
266.8 |
| Isoelectric point (calc.) |
5.1 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LDDIDKGLIL/LKNKLESDLYL/LQKIVYSDLPL/LGFFDSLCI/LEELLISLDI/LHNPLPFELEI |
| Localization (YFP) |
cytosol; cytoplasmic
dots |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |