| Gene name |
SPAC56E4.04c |
| Gene ID |
34/C12 |
| Gene synonyms/obsolete |
cut6 |
| Gene product |
acetyl-CoA
carboxylase; carbamoyl-phosphate synthase; biotin dependent
carboxylase; involved in chromosome segregation; mutant (t-s)
shows defects in nuclear division; essential; involved in
fatty acid biosynthesis; involved in cytokinesis; involved in
cell separation |
| Entry clone |
Cloned |
| ORF length (unspliced) |
7465 |
| ORF length (spliced) |
6843 |
| Entry clone length |
7465 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
3092A:G / 3204T:C /
4333T:C / 4525T:C / 5204A:G / 5513A:G / 5547A:G / 5662C:A /
6505T:C / 6630T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC56E4.04.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCGCCAGAGCGTTACCTC |
| Rev primer name |
SPAC56E4.04.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAATTAACCGACGCGAGTTTT |
| Amino acid length |
2280 |
| Molecular weight |
256.8 |
| Isoelectric point (calc.) |
6.3 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LKVQIAPLLKI/LALAIDRLPL |
| Localization (YFP) |
cytosol; cytoplasmic
dots; vacuole membrane |
| Comments for localization |
|
| Effect of LMB on protein
localization |
changed to:
cytosol=nucleus, partially; cytoplasmic dots; vacuole
membrane |
| Microscope used for
observation |
Leica |