| Gene name |
SPBC3H7.16 |
| Gene ID |
34/D02 |
| Gene synonyms/obsolete |
SPBC28E12.06c |
| Gene product |
lysosomal trafficking
regulator; WD repeat protein; Beach domain; zinc finger
protein; zf-FYVE type; beige protein homolog |
| Entry clone |
Cloned |
| ORF length (unspliced) |
7830 |
| ORF length (spliced) |
|
| Entry clone length |
7830 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
2451A:G / 4370T:C /
5889A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC3H7.16.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGACAGAAAGGCGAATGC |
| Rev primer name |
SPBC3H7.16.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAATTCTTATAACATAAAGGC |
| Amino acid length |
2609 |
| Molecular weight |
295.6 |
| Isoelectric point (calc.) |
6.8 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LTASLDLTLRL |
| Localization (YFP) |
cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |