| Gene name |
SPCC23B6.03c |
| Gene ID |
34/D04 |
| Gene synonyms/obsolete |
tel1 |
| Gene product |
phosphotidylinositol
kinase; involved in telomere maintenance; involved in
telomerase-dependent telomere maintenance |
| Entry clone |
Cloned |
| ORF length (unspliced) |
8439 |
| ORF length (spliced) |
|
| Entry clone length |
8439 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
555T:C / 1027T:C /
1968T:C / 3876A:C / 5405A:G / 6811T:C / 8270A:G /
8419G:A |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPCC23B6.03.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGACTTCTCTAAATGACAT |
| Rev primer name |
SPCC23B6.03.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATTGAAAGGCAGACCATCCA |
| Amino acid length |
2812 |
| Molecular weight |
327.1 |
| Isoelectric point (calc.) |
7 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LRLQLIQCLAI/LMMIFYRPLSL/LYKGFCYLYL/LFRIYRLEI/LEEYINKKLLL/LHECFQLLLEI |
| Localization (YFP) |
cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Confocal |