Gene name |
SPCC1235.14 |
Gene ID |
34/E03 |
Gene synonyms/obsolete |
ght5 |
Gene product |
hexose transporter;
similar to Sp GHT1 and GHT2 and GHT4 and GHT3 and GHT6 and
SPCC548.06C and SPBC1348.14C; tandem duplication |
Entry clone |
Cloned# |
ORF length (unspliced) |
1641 |
ORF length (spliced) |
|
Entry clone length |
1641 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPCC1235.14.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGGAAAAAATTTGACCAT |
Rev primer name |
SPCC1235.14.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATGCGAATTGTTCTTCCTGA |
Amino acid length |
546 |
Molecular weight |
60.3 |
Isoelectric point (calc.) |
5.8 |
Signal SEQ |
Predicted
(N-terminus) |
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LEEINELYI |
Localization (YFP) |
periphery with
discontinuity |
Comments for localization |
periphery except
septum |
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |