Gene name |
SPBC15D4.02 |
Gene ID |
34/E09 |
Gene synonyms/obsolete |
|
Gene product |
zinc finger protein;
zf-fungal Zn(2)-Cys(6) binuclear cluster domain; involved in
transcriptional regulation; no apparent Sc ortholog |
Entry clone |
Cloned |
ORF length (unspliced) |
1644 |
ORF length (spliced) |
|
Entry clone length |
1644 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
36A:G |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC15D4.02.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGAGTATCATCCTTCTTC |
Rev primer name |
SPBC15D4.02.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATTGACAACCAATGGCTAAA |
Amino acid length |
547 |
Molecular weight |
59.6 |
Isoelectric point (calc.) |
8.7 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
166 |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LLAVTQLYI/LASGLNPLPL/LDESLFHLGL/LPRLALLMI |
Localization (YFP) |
nucleus |
Comments for localization |
nuclear dots by over
expression |
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |