| Gene name |
SPAC26F1.10c |
| Gene ID |
34/F11 |
| Gene synonyms/obsolete |
pyp1 |
| Gene product |
protein-tyrosine
phosphatase; negative regulator of mitosis; negative regulator
of nutrient monitoring pathways; dephosphorylate an
osmosensing MAP kinase controlling cell size at division;
similar to Sp pyp2 |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1653 |
| ORF length (spliced) |
|
| Entry clone length |
1653 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC26F1.10.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAATTTTTCAAACGGTTC |
| Rev primer name |
SPAC26F1.10.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATGTTAAAACCGGGAAATGA |
| Amino acid length |
550 |
| Molecular weight |
61.5 |
| Isoelectric point (calc.) |
8.1 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nucleus>cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica;
DeltaVision |