| Gene name |
SPBC409.11 |
| Gene ID |
34/G12 |
| Gene synonyms/obsolete |
meu18 |
| Gene product |
predicted coiled-coil;
NLS; meiotic expression upregulated; no apparent
orthologs |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1662 |
| ORF length (spliced) |
|
| Entry clone length |
1662 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
661A:G / 903A:G /
1085G:C / 1101A:T / 1278A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC409.11.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGATTTACATAAACTTTTA |
| Rev primer name |
SPBC409.11.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATACCAACAAATTGGTCTCC |
| Amino acid length |
553 |
| Molecular weight |
64.7 |
| Isoelectric point (calc.) |
8.1 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
289 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LIPSFHVCLLI/LLYCFHYALDL/LTTIGNNLRI |
| Localization (YFP) |
nuclear envelope;
periphery; cytoplasmic dots |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |