| Gene name |
SPCC777.02 |
| Gene ID |
34/H10 |
| Gene synonyms/obsolete |
|
| Gene product |
involved in
transcriptional regulation; zinc finger protein; zf-fungal
Zn(2)-Cys(6) binuclear cluster domain; similar to Sp
SPCC757.04 (paralog) |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2193 |
| ORF length (spliced) |
1809 |
| Entry clone length |
2193 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPCC777.02.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTACAAAGTAAATCCCTC |
| Rev primer name |
SPCC777.02.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAAATTGAGGACCTCCAAAA |
| Amino acid length |
602 |
| Molecular weight |
68.3 |
| Isoelectric point (calc.) |
6.4 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LYFFLIRLCL |
| Localization (YFP) |
nucleus>cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |