| Gene name |
SPAC21E11.05c |
| Gene ID |
35/D06 |
| Gene synonyms/obsolete |
cyp8 |
| Gene product |
cyclophilin;
peptidyl-prolyl cis-trans isomerase; no apparent Sc ortholog;
U-box domain (inferred from context); ubiquitin-protein ligase
(E4) |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1700 |
| ORF length (spliced) |
1416 |
| Entry clone length |
1700 |
| No. of intron |
3 |
| Sequence status |
Finished |
| Sequence results |
25G:addition |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC21E11.05.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGGTGGCATGGTGGTATG |
| Rev primer name |
SPAC21E11.05.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACCATGCGTCAAAATTTCCA |
| Amino acid length |
471 |
| Molecular weight |
53.5 |
| Isoelectric point (calc.) |
9.3 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |