Gene name |
SPBC19G7.09 |
Gene ID |
35/E03 |
Gene synonyms/obsolete |
ulp1 |
Gene product |
Ulp1 protease family;
peptidase family C48; cysteine protease; Pmt3 (SUMO)-specific
protease; involved in protein deubiquitination and protein
desumoylation; non-essential; involved in nuclear morphology
maintenance |
Entry clone |
Cloned |
ORF length (unspliced) |
1707 |
ORF length (spliced) |
|
Entry clone length |
1707 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
266A:G |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPBC19G7.09.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGATAGGAAAACGCAATGC |
Rev primer name |
SPBC19G7.09.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAATAGATTTGTGCATCAATA |
Amino acid length |
568 |
Molecular weight |
64.9 |
Isoelectric point (calc.) |
9.7 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
23 |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
nuclear envelope;
cytosol |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |