| Gene name |
SPCC306.09c |
| Gene ID |
35/G03 |
| Gene synonyms/obsolete |
cap1; cap |
| Gene product |
actin cortical patch
component; adenylyl cyclase-associated protein |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1730 |
| ORF length (spliced) |
1656 |
| Entry clone length |
1730 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
21A:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPCC306.09.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCGGATATGATCAATAT |
| Rev primer name |
SPCC306.09.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATTCGTGACGTACAATCTCA |
| Amino acid length |
551 |
| Molecular weight |
60.2 |
| Isoelectric point (calc.) |
6.8 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
cytoplasmic dots;
Golgi? |
| Comments for localization |
bright large dots by
over expression |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |