| Gene name |
SPAC13C5.03 |
| Gene ID |
35/G11 |
| Gene synonyms/obsolete |
tht1 |
| Gene product |
nuclear fusion
protein; required for the fusion of nuclear; envelopes during
karyogamy |
| Entry clone |
Cloned (also cloned in
2004 trial) |
| ORF length (unspliced) |
1736 |
| ORF length (spliced) |
1632 |
| Entry clone length |
1736 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC13C5.03.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAAATTTCATCCGACGCG |
| Rev primer name |
SPAC13C5.03.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAATCCCACCATGGAGATTGC |
| Amino acid length |
543 |
| Molecular weight |
62.9 |
| Isoelectric point (calc.) |
6.3 |
| Signal SEQ |
|
| No. of transmembrane domain |
3 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LSSLFFKVLKI |
| Localization (YFP) |
cytoplasmic dots; ER?;
Golgi? |
| Comments for localization |
ER-Golgi? |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |