| Gene name |
SPBC21B10.09 |
| Gene ID |
36/B02 |
| Gene synonyms/obsolete |
|
| Gene product |
acetyl-coenzyme A
transporter |
| Entry clone |
Cloned; Mixture |
| ORF length (unspliced) |
1757 |
| ORF length (spliced) |
1560 |
| Entry clone length |
1757 |
| No. of intron |
3 |
| Sequence status |
Finished |
| Sequence results |
Mixture |
| Comments |
Mixture of 2 clones,
one of which is frameshifted from somewhere. |
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPBC21B10.09.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGTCTTTAAGGCTCACCA |
| Rev primer name |
SPBC21B10.09.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATGTATACGTTTCGGCAATT |
| Amino acid length |
519 |
| Molecular weight |
58.2 |
| Isoelectric point (calc.) |
8.7 |
| Signal SEQ |
|
| No. of transmembrane domain |
10 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LKNMRQLLI/LSNEMLSLII/LINFPLGLAL/LTSIVGIFLAI |
| Localization (YFP) |
cytoplasmic dots;
Golgi? |
| Comments for localization |
Golgi? |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |