| Gene name |
SPAC1002.10c |
| Gene ID |
36/C02 |
| Gene synonyms/obsolete |
|
| Gene product |
eukaryotic conserved
protein; no apparent Sc ortholog |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1773 |
| ORF length (spliced) |
|
| Entry clone length |
1773 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
712A:G / 733T:C /
800T:C / 1227A:G / 1581T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC1002.10.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGCAATCTAGGCAATAA |
| Rev primer name |
SPAC1002.10.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATTTTTCTCTCGGTATCTGT |
| Amino acid length |
590 |
| Molecular weight |
68.1 |
| Isoelectric point (calc.) |
4.2 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LAELERLQL |
| Localization (YFP) |
cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
changed to:
nucleus>>cytosol |
| Microscope used for
observation |
Leica |