| Gene name |
SPBC651.09c |
| Gene ID |
36/C08 |
| Gene synonyms/obsolete |
|
| Gene product |
RNA polymerase II
associated Paf1 complex; involved in TATA site selection;
involved in regulation of transcription elongation |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1780 |
| ORF length (spliced) |
1683 |
| Entry clone length |
1780 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
145A:G / 1480A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC651.09.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCCGACTTTCAGGATGA |
| Rev primer name |
SPBC651.09.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAATGTTGATATCAATGCCA |
| Amino acid length |
560 |
| Molecular weight |
63.6 |
| Isoelectric point (calc.) |
5.2 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |