Gene name |
SPBC2F12.12c |
Gene ID |
36/C12 |
Gene synonyms/obsolete |
|
Gene product |
hypothetical protein;
interacts with ankyrin repeat containing protein by similarity
to D.melanogaster cactin; no apparent Sc ortholog;
non-essential |
Entry clone |
Cloned |
ORF length (unspliced) |
1784 |
ORF length (spliced) |
1554 |
Entry clone length |
1784 |
No. of intron |
4 |
Sequence status |
Finished |
Sequence results |
541A:G / 1128T:A |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC2F12.12.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCATTTCGTGATTCAAC |
Rev primer name |
SPBC2F12.12.Rv |
Rev primer SEQ |
AGAAAGCTGGGTACCTTCTATGATGAAGCTTT |
Amino acid length |
517 |
Molecular weight |
60.8 |
Isoelectric point (calc.) |
9.5 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LKKTFNEELQI |
Localization (YFP) |
nucleus;
mitochondrion |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Confocal |