| Gene name |
SPBC19F5.03 |
| Gene ID |
36/D10 |
| Gene synonyms/obsolete |
|
| Gene product |
inositol
polyphosphoinositide phosphatase; 2 predicted transmembrane
helices; ER/golgi ATP/ADP exchanger; involved in transport of
ATP into ER which plays a role in Golgi function and actin
cytoskeletal organization |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1797 |
| ORF length (spliced) |
|
| Entry clone length |
1797 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
495T:C / 568A:G /
1531T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC19F5.03.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGTTCAGTTTGAAGCAAA |
| Rev primer name |
SPBC19F5.03.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAACTTTATGCTTCGAAGCG |
| Amino acid length |
598 |
| Molecular weight |
68.7 |
| Isoelectric point (calc.) |
8.9 |
| Signal SEQ |
|
| No. of transmembrane domain |
2 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LLILTFLGI |
| Localization (YFP) |
ER |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |