| Gene name |
SPAC3A11.02 |
| Gene ID |
36/E10 |
| Gene synonyms/obsolete |
scp3 |
| Gene product |
zinc finger protein;
zf-CCCH type; spindle poison (isopropyl N-3-chlorophenyl
carbamate) sensitivity protein |
| Entry clone |
Cloned in 2006
trial |
| ORF length (unspliced) |
1810 |
| ORF length (spliced) |
1752 |
| Entry clone length |
1810 |
| No. of intron |
1 |
| Sequence status |
Partially
sequenced |
| Sequence results |
100% match in both
ends |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPAC3A11.02.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGACGAAGAAAAATGCCTT |
| Rev primer name |
SPAC3A11.02.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAGCTTCATCCATTTGGAAT |
| Amino acid length |
583 |
| Molecular weight |
62.8 |
| Isoelectric point (calc.) |
8.5 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
changed to:
nucleus>cytosol (intranuclear microtubule bundle?) |
| Microscope used for
observation |
DeltaVision |