| Gene name |
SPBC530.12c |
| Gene ID |
36/F01 |
| Gene synonyms/obsolete |
yhc1 |
| Gene product |
N-terminal
palmitoyl-protein thioesterase domain; C-terminal
phoshphatidic acid phosphatase domain (PAP2); domain
combination not observed in other organisms; related toSc
YGR036C; no apparent orthologs |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1812 |
| ORF length (spliced) |
|
| Entry clone length |
1812 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
1012T:C /
1063A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC530.12.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAAAAGTTTTGCAATACC |
| Rev primer name |
SPBC530.12.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAATTAGACTTTTGGTTCTTG |
| Amino acid length |
603 |
| Molecular weight |
68.9 |
| Isoelectric point (calc.) |
6.2 |
| Signal SEQ |
|
| No. of transmembrane domain |
5 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LSNGFYALGL |
| Localization (YFP) |
ER |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |