| Gene name |
SPAC1F3.05 |
| Gene ID |
36/F04 |
| Gene synonyms/obsolete |
|
| Gene product |
VHS domain; involved
in intracellular protein transport; involved in trafficking of
proteins between the trans-Golgi network and the vacuole |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1815 |
| ORF length (spliced) |
1533 |
| Entry clone length |
1815 |
| No. of intron |
3 |
| Sequence status |
Finished |
| Sequence results |
630A:G / 1792G:A |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC1F3.05.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCGCTCTAGCCAGACTTT |
| Rev primer name |
SPAC1F3.05.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACAGCGGAAGATGCGATTCG |
| Amino acid length |
510 |
| Molecular weight |
56.7 |
| Isoelectric point (calc.) |
5.2 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LLSLNDLLI |
| Localization (YFP) |
Golgi;
nucleus>cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica,
DeltaVision |