Gene name |
SPBP8B7.20c |
Gene ID |
36/F10 |
Gene synonyms/obsolete |
|
Gene product |
methyltransferase;
NOL1/NOP2/sun family; involved in RNA methylation; involved in
RNA processing |
Entry clone |
Cloned |
ORF length (unspliced) |
1827 |
ORF length (spliced) |
|
Entry clone length |
1827 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBP8B7.20.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGGAAGAAAACAGAAGTC |
Rev primer name |
SPBP8B7.20.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAATCCTTTTTTTTTGCAACC |
Amino acid length |
608 |
Molecular weight |
68.9 |
Isoelectric point (calc.) |
4.7 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LSHLQRQLLL |
Localization (YFP) |
nucleus |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica |