| Gene name |
SPAC1A6.04c |
| Gene ID |
36/G12 |
| Gene synonyms/obsolete |
|
| Gene product |
lysophospholipase;
phospholipase B Homolog; involved in response to osmotic
stress; mediator of nutrient-dependent repression of sexual
differentiation; tandem duplication; similar to Sp SPAC1A6.03C
and SPAC1348.10C and SPAC977.09C and SPCC1450.09C and
SPAC1786.02 |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1842 |
| ORF length (spliced) |
|
| Entry clone length |
1842 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
203A:G / 1065T:A /
1068T:C / 1253T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC1A6.04.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCTTTTCCGCGGATTAAG |
| Rev primer name |
SPAC1A6.04.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAATGCCTTCACCAAGACGG |
| Amino acid length |
613 |
| Molecular weight |
67.1 |
| Isoelectric point (calc.) |
4.5 |
| Signal SEQ |
Predicted
(N-terminus) |
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LASCLSALAL |
| Localization (YFP) |
cytosol=nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |