| Gene name |
SPAC4G8.12c |
| Gene ID |
36/H12 |
| Gene synonyms/obsolete |
|
| Gene product |
PMP protein; involved
in GPI anchor biosynthesis (SGD); alpha-1,2
mannosyltransferase; involved in addition of the fourth,
side-branching mannose onto the GPI core structure (SGD) |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1889 |
| ORF length (spliced) |
1602 |
| Entry clone length |
1889 |
| No. of intron |
5 |
| Sequence status |
Finished |
| Sequence results |
36T:C / 942C:T /
1286T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC4G8.12.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTTTAAAAACCGTAAATA |
| Rev primer name |
SPAC4G8.12.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATCCCACACTTCTCAATACC |
| Amino acid length |
533 |
| Molecular weight |
62.2 |
| Isoelectric point (calc.) |
8.6 |
| Signal SEQ |
Predicted
(N-terminus) |
| No. of transmembrane domain |
7 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LYMCLISLLI/LLPVFILSL |
| Localization (YFP) |
ER |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |