| Gene name |
SPAC17G6.03 |
| Gene ID |
37/A04 |
| Gene synonyms/obsolete |
|
| Gene product |
calcineurin-like
phosphoesterase; similar to Sp SPAC1039.02 and SPBPB2B2.06c
(paralogs) |
| Entry clone |
Cloned# |
| ORF length (unspliced) |
1908 |
| ORF length (spliced) |
|
| Entry clone length |
1908 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPAC17G6.03.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAAACCTGCCCATACATT |
| Rev primer name |
SPAC17G6.03.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACTTATATAGGCAATCGTGG |
| Amino acid length |
635 |
| Molecular weight |
71.4 |
| Isoelectric point (calc.) |
5.5 |
| Signal SEQ |
Predicted
(N-terminus) |
| No. of transmembrane domain |
1 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LDIVLSELRI |
| Localization (YFP) |
cytosol; cytoplasmic
dots |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |