| Gene name |
SPBC21D10.05c |
| Gene ID |
37/B10 |
| Gene synonyms/obsolete |
|
| Gene product |
GTPase activating
protein; UBA domain; involved in protein deubiquitination
(implicated); ubiquitin-binding protein; overexpression
supresses cdc2 mutant (pers. comm. Nancy Walworth) |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2013 |
| ORF length (spliced) |
1806 |
| Entry clone length |
2013 |
| No. of intron |
3 |
| Sequence status |
Finished |
| Sequence results |
320T:deletion / 638A:G
/ 1452C:T |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC21D10.05.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCTGGACGGAGAAATGA |
| Rev primer name |
SPBC21D10.05.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATTGCTTTCCTTGCATAATG |
| Amino acid length |
601 |
| Molecular weight |
65.5 |
| Isoelectric point (calc.) |
6.5 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LPDMSKLSL |
| Localization (YFP) |
cytoplasmic dots at
cell tip and site of septum formation; cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
changed to:
nucleus>cytosol; cytoplasmic dots at cell tip and site of
septum formation |
| Microscope used for
observation |
Leica |