| Gene name |
SPAC664.11 |
| Gene ID |
37/B12 |
| Gene synonyms/obsolete |
ssc1; ssp1 |
| Gene product |
mitochondrial
chaperonin; heat shock protein 70 family; involved in
mitochondrial protein import; nvolved in heat shock response;
involved in stress response |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2025 |
| ORF length (spliced) |
|
| Entry clone length |
2025 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
93A:T |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC664.11.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGATCTCGTCGAGATTCAC |
| Rev primer name |
SPAC664.11.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACTTCTTGTCACCCTCAGGA |
| Amino acid length |
674 |
| Molecular weight |
72.9 |
| Isoelectric point (calc.) |
7.1 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LSGHVKDLVL |
| Localization (YFP) |
mitochondrion |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |