| Gene name |
SPCC4G3.10c |
| Gene ID |
37/C07 |
| Gene synonyms/obsolete |
rhp42; rhp4b |
| Gene product |
involved in DNA
repair; involved in nucleotide-excision repair; involved in
mismatch repair; XP-C family; similar to Sc YER162C; similar
to Sp rhp41 (paralog) |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2061 |
| ORF length (spliced) |
|
| Entry clone length |
2061 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPCC4G3.10.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCCACCCAAACGCAAAGC |
| Rev primer name |
SPCC4G3.10.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAGCATATTGTTCTTCAATA |
| Amino acid length |
686 |
| Molecular weight |
79 |
| Isoelectric point (calc.) |
8.9 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
3 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nucleolus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |