| Gene name |
SPAC6F12.15c |
| Gene ID |
37/D09 |
| Gene synonyms/obsolete |
cut9 |
| Gene product |
anaphase-promoting
complex (APC); cyclosome; involved in cyclin degradation
(required); involved in mitotic metaphase/anaphase transition
(required); TPR repeat protein; involved in metaphase-anaphase
transition (required) |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2125 |
| ORF length (spliced) |
2016 |
| Entry clone length |
2125 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
242T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC6F12.15.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGTCGTTAAACGAACGCA |
| Rev primer name |
SPAC6F12.15.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATCGTTGCTCTGAGACATTA |
| Amino acid length |
671 |
| Molecular weight |
75.8 |
| Isoelectric point (calc.) |
5.7 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LRSLYMLKL/LHKKIPGLAI |
| Localization (YFP) |
cytosol |
| Comments for localization |
cytoplasmic dots by
over expression |
| Effect of LMB on protein
localization |
changed to:
cytosol>nucleus |
| Microscope used for
observation |
Leica |