Gene name |
SPBC776.10c |
Gene ID |
37/E04 |
Gene synonyms/obsolete |
|
Gene product |
golgi transport
complex (peripheral subunit); involved in intracellular
protein transport; involved in secretory pathway; involved in
ER to golgi transport |
Entry clone |
Cloned |
ORF length (unspliced) |
2136 |
ORF length (spliced) |
2028 |
Entry clone length |
2136 |
No. of intron |
2 |
Sequence status |
Finished |
Sequence results |
403A:G |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC776.10.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGATGTGAAATCCAAGCA |
Rev primer name |
SPBC776.10.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAGTTTACTGATAAATTGTCT |
Amino acid length |
675 |
Molecular weight |
77.3 |
Isoelectric point (calc.) |
4.5 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LSETIDNLQL |
Localization (YFP) |
nucleus>=cytosol;
periphery at site of septum formation |
Comments for localization |
aggregates by over
expression |
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |