| Gene name |
SPAC24H6.06 |
| Gene ID |
37/E10 |
| Gene synonyms/obsolete |
|
| Gene product |
preinitiation complex
component; involved in DNA replication (initiation); involved
in Cdc45p loading onto chromatin; interacts physically with
Cdc45p; interacts physically with MCM proteins; associates
with the replication origin during G1-S phase; predicted
coiled-coil region |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2148 |
| ORF length (spliced) |
2007 |
| Entry clone length |
2148 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
139A:G / 316C:T /
822T:G / 958A:G / 1299C:T |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC24H6.06.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAATAACGACCATGCTTC |
| Rev primer name |
SPAC24H6.06.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAGGACTGGCTGATTTTTTT |
| Amino acid length |
668 |
| Molecular weight |
75.8 |
| Isoelectric point (calc.) |
9.9 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LEFTFDGLCI |
| Localization (YFP) |
nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |