Gene name |
SPBC1703.07 |
Gene ID |
37/F10 |
Gene synonyms/obsolete |
|
Gene product |
ATP citrate synthase
(subunit 1) (similar to ATP citrate synthase C-terminal
domain); involved in tricarboxylic acid cycle; involved in
citrate metabolism; involved in ATP catabolism; involved in
acetyl-CoA biosynthesis; involved in fatty acid biosynthesis;
ATP citrate synthase activity; no apparent Sc ortholog |
Entry clone |
Cloned |
ORF length (unspliced) |
2159 |
ORF length (spliced) |
1848 |
Entry clone length |
2159 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC1703.07.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCGGGATCAGTGGATAA |
Rev primer name |
SPBC1703.07.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAGACAAATACAAGAAATCG |
Amino acid length |
615 |
Molecular weight |
67.2 |
Isoelectric point (calc.) |
7.9 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
cytosol=nucleus |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica |