Gene name |
SPAC1751.01c |
Gene ID |
37/G01 |
Gene synonyms/obsolete |
gti1 |
Gene product |
experimentally
characterised; DeSpription required for gluconate-H+ symport;
anion transport; similar to Sp pac2 |
Entry clone |
Cloned |
ORF length (unspliced) |
2163 |
ORF length (spliced) |
|
Entry clone length |
2163 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
1659T:C /
2049T:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC1751.01.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGACCGAACCTGGCAATCT |
Rev primer name |
SPAC1751.01.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATGACAAGGAGCCGCGTTCT |
Amino acid length |
720 |
Molecular weight |
78.7 |
Isoelectric point (calc.) |
8.2 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
nucleus>>cytosol; nuclear dots |
Comments for localization |
|
Effect of LMB on protein
localization |
changed to: nucleus;
nuclear dots |
Microscope used for
observation |
Leica |