Gene name |
SPAC343.16 |
Gene ID |
37/G03 |
Gene synonyms/obsolete |
|
Gene product |
homoaconitate
hydratase; involved in lysine biosynthesis; functionally
complements lys2-97 (pers. comm. Richard Hoffman) |
Entry clone |
Cloned |
ORF length (unspliced) |
2166 |
ORF length (spliced) |
|
Entry clone length |
2166 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
49G:A / 348T:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC343.16.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGACAGTGGTGAGATGCA |
Rev primer name |
SPAC343.16.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAATTGGATTTGGAAATTTCA |
Amino acid length |
721 |
Molecular weight |
78 |
Isoelectric point (calc.) |
8 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
mitochondrion |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica |