| Gene name |
SPCC830.05c |
| Gene ID |
37/H06 |
| Gene synonyms/obsolete |
|
| Gene product |
histone
acetyltransferase complex |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2195 |
| ORF length (spliced) |
1674 |
| Entry clone length |
2195 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
403A:T / 463T:deletion
/ 464T:deletion / 834A:G / 1293A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPCC830.05.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGTTCCGTCTCCAAAAA |
| Rev primer name |
SPCC830.05.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATGACTGAGTACCCATATCA |
| Amino acid length |
557 |
| Molecular weight |
64.6 |
| Isoelectric point (calc.) |
8.4 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LRQSMETSLQL/LVKKLKRTLNI |
| Localization (YFP) |
nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |