| Gene name |
SPBC31F10.16 |
| Gene ID |
37/H07 |
| Gene synonyms/obsolete |
|
| Gene product |
ChAPs family protein;
conserved fungal protein; involved in cell wall organization
and biogenesis (maintenance) |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2199 |
| ORF length (spliced) |
2040 |
| Entry clone length |
2199 |
| No. of intron |
3 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC31F10.16.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGTGATTCATTCTTTAA |
| Rev primer name |
SPBC31F10.16.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACAATTCATGGCCAGGAATT |
| Amino acid length |
679 |
| Molecular weight |
77.5 |
| Isoelectric point (calc.) |
5.9 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LKQRMSASLLI/LTAIAKLTL |
| Localization (YFP) |
nucleus>cytosol;
cytoplasmic dots; periphery at site of septum formation |
| Comments for localization |
|
| Effect of LMB on protein
localization |
changed to:
nucleus>>cytosol; cytoplasmic dots |
| Microscope used for
observation |
Leica |