| Gene name |
SPBC1861.01c |
| Gene ID |
37/H08 |
| Gene synonyms/obsolete |
SPBC56F2.13 |
| Gene product |
AT hook protein;
centromeric DNA binding; involved in mitotic spindle integrity
(anaphase); involved in spindle elongation |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2199 |
| ORF length (spliced) |
1932 |
| Entry clone length |
2199 |
| No. of intron |
3 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC1861.01.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGACGATGAATGAAACGTC |
| Rev primer name |
SPBC1861.01.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATCGTTCGTTTGGAAAATCC |
| Amino acid length |
643 |
| Molecular weight |
72 |
| Isoelectric point (calc.) |
10 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nucleolus>nucleus;
SPB |
| Comments for localization |
nuclear dots by over
expression |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |