Gene name |
SPAC222.02c |
Gene ID |
38/B11 |
Gene synonyms/obsolete |
SPAC1687.22c |
Gene product |
RNA-binding protein;
pumilio family |
Entry clone |
Cloned
(Re-cloned) |
ORF length (unspliced) |
2303 |
ORF length (spliced) |
2199 |
Entry clone length |
2303 |
No. of intron |
2 |
Sequence status |
Finished |
Sequence results |
781G:C |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPAC222.02.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTTTACTGCTGTAAATTC |
Rev primer name |
SPAC222.02.Rv |
Rev primer SEQ |
AGAAAGCTGGGTACTTGCATTCCTTGCTGGCC |
Amino acid length |
732 |
Molecular weight |
81 |
Isoelectric point (calc.) |
8 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
cytosol; cytoplasmic
dots |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica;
DeltaVision |