| Gene name |
SPAC30D11.03 |
| Gene ID |
38/C09 |
| Gene synonyms/obsolete |
|
| Gene product |
DEAD/DEAH box
helicase; helicase C-terminal domain; involved in 35S
transcript processing; ATP-dependent; RNA helicase |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2356 |
| ORF length (spliced) |
2265 |
| Entry clone length |
2356 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
140T:C / 648T:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC30D11.03.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCTTTGGAATACGCAGTA |
| Rev primer name |
SPAC30D11.03.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATTTGCGCTTAGATTTCGAT |
| Amino acid length |
754 |
| Molecular weight |
85.4 |
| Isoelectric point (calc.) |
5.4 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
717 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nucleolus>>nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica,
DeltaVision |