Gene name |
SPCC663.01c |
Gene ID |
38/D12 |
Gene synonyms/obsolete |
SPCC777.16c |
Gene product |
sap2 family; cell
cycle dependent phosphatase-associated protein; involved in
chromosome segregation |
Entry clone |
Cloned |
ORF length (unspliced) |
2574 |
ORF length (spliced) |
2517 |
Entry clone length |
2574 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPCC663.01.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTTTTGGAGATTGGGCCA |
Rev primer name |
SPCC663.01.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATTTACCATGGTTCTATATG |
Amino acid length |
838 |
Molecular weight |
94.9 |
Isoelectric point (calc.) |
4 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LPVIGDFLKI |
Localization (YFP) |
nucleus>>cytosol |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica |