Gene name |
SPCC1183.01 |
Gene ID |
38/E05 |
Gene synonyms/obsolete |
sec15;
SPCC1672.13 |
Gene product |
involved in secretory
pathway; involved in exocytosis |
Entry clone |
Cloned |
ORF length (unspliced) |
2584 |
ORF length (spliced) |
2358 |
Entry clone length |
2584 |
No. of intron |
4 |
Sequence status |
Finished |
Sequence results |
2538A:G |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPCC1183.01.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGATATAGATGTCTTGGA |
Rev primer name |
SPCC1183.01.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATCTTTTCTTCAAAGTAGCT |
Amino acid length |
785 |
Molecular weight |
90.5 |
Isoelectric point (calc.) |
5.4 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LFSIRQKLPL/LIDAFGGALIL/LKSLYPKLAL/LLQIEKSLVL |
Localization (YFP) |
cell tip; site of
septum formation; cytosol |
Comments for localization |
aggregates by over
expression |
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |