| Gene name |
SPCC1183.01 |
| Gene ID |
38/E05 |
| Gene synonyms/obsolete |
sec15;
SPCC1672.13 |
| Gene product |
involved in secretory
pathway; involved in exocytosis |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2584 |
| ORF length (spliced) |
2358 |
| Entry clone length |
2584 |
| No. of intron |
4 |
| Sequence status |
Finished |
| Sequence results |
2538A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPCC1183.01.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGATATAGATGTCTTGGA |
| Rev primer name |
SPCC1183.01.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATCTTTTCTTCAAAGTAGCT |
| Amino acid length |
785 |
| Molecular weight |
90.5 |
| Isoelectric point (calc.) |
5.4 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LFSIRQKLPL/LIDAFGGALIL/LKSLYPKLAL/LLQIEKSLVL |
| Localization (YFP) |
cell tip; site of
septum formation; cytosol |
| Comments for localization |
aggregates by over
expression |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |