| Gene name |
SPCP1E11.06 |
| Gene ID |
38/E09 |
| Gene synonyms/obsolete |
apl4 |
| Gene product |
AP-1 adaptor complex
gamma subunit; adaptin family; HEAT repeat; involved in
vesicle-mediated transport |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2598 |
| ORF length (spliced) |
|
| Entry clone length |
2598 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
684T:C / 914A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPCP1E11.06.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCAAACAACACATCCAAA |
| Rev primer name |
SPCP1E11.06.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATTGTAAAAGGTCAGATGGC |
| Amino acid length |
865 |
| Molecular weight |
96 |
| Isoelectric point (calc.) |
8.5 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
64 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LGYLAAMLLL/LQVKILQFLSI/LYQAVRTILDL |
| Localization (YFP) |
Golgi; cytoplasmic
dots |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |