| Gene name |
SPBC16A3.11 |
| Gene ID |
38/F08 |
| Gene synonyms/obsolete |
eso1 |
| Gene product |
involved in sister
chromatid cohesion (required) (S phase); involved in cell
cycle regulation; IMS1 domain |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2619 |
| ORF length (spliced) |
|
| Entry clone length |
2619 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC16A3.11.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGAATTAGGCAAAAGCAA |
| Rev primer name |
SPBC16A3.11.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAACTTTCATAAACAGCATAT |
| Amino acid length |
872 |
| Molecular weight |
98.9 |
| Isoelectric point (calc.) |
7.7 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nucleus; a few nuclear
dots |
| Comments for localization |
|
| Effect of LMB on protein
localization |
changed to:
intranuclear microtubule bundle (nucleus) |
| Microscope used for
observation |
DeltaVision |