| Gene name |
SPAC13G6.12c |
| Gene ID |
38/F11 |
| Gene synonyms/obsolete |
chs1;
SPAC24B11.01c |
| Gene product |
chitin synthase 1;
chitin synthase activity; essential; involved in sporulation
(required) |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2626 |
| ORF length (spliced) |
2580 |
| Entry clone length |
2626 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
536A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC13G6.12.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGAAGGTGGTTCAAAAA |
| Rev primer name |
SPAC13G6.12.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATTCTCCCGTACAAAGTCTA |
| Amino acid length |
859 |
| Molecular weight |
97.9 |
| Isoelectric point (calc.) |
8.5 |
| Signal SEQ |
|
| No. of transmembrane domain |
7 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LYPTITNLSL/LTWILSNLFL |
| Localization (YFP) |
ER |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |